Direttore: avv. Giuseppe Castronovo



Scaricare 87.17 Kb.
Pagina6/6
02.02.2018
Dimensione del file87.17 Kb.
1   2   3   4   5   6

della solidarietà. Occuparsi del Burkina

Faso è un po’ come avere a cuore gli “ultimi della

Terra”, abitanti di un

Paese che hanno il

sorriso sul volto ma, al

contempo, l’ombra

della malattia dietro

le spalle. Però la

IAPB Toscana, grazie

a un progetto che dura

da diversi anni, sta

portando avanti una

serie d’iniziative degne

di nota. Le attività si

concentrano, da un

lato, sulla città di Leo

e, dall’altro sulla capitale

(Ouagadougou).

Si svolgono, tra l’altro, corsi specifici di

formazione per gli infermieri così come per gli oculisti.

Al contempo è stato necessario portare nuove

attrezzature e ulteriori mezzi che consentano agli

operatori locali di prevenire la cecità e di trattare

le patologie oculari anche chirurgicamente (cataratta,

glaucoma, retinopatia diabetica, ecc.). Il

Presidente del Comitato toscano della IAPB Italia

onlus, Giorgio Ricci, rientrato dal Burkina

Faso, racconta lo spirito e la realtà della missione.

Ricci, ci può spiegare quali attività sono

in corso e quali state pianificando?

Sono due le azioni fondamentali che portiamo

avanti. La prima è quella di continuare a supportare

il centro storico dove operavamo a Leo

(vicino al confine col

Ghana), dove viene

portata avanti l’attività

del progetto. Abbiamo

un operatore

che fa una missione

al mese: in un weekend

fa 50-70 interventi

di cataratta e

questo è ciò che è necessario

in quella

zona. In molti paesi

in Africa questa è la

scelta più compatibile

e più logica in queste

realtà [col numero di

operatori disponibili, dato che il numero di oculisti

è estremamente basso rispetto agli standard

europei], soprattutto nelle periferie: ha un bassissimo

costo ed è assolutamente idonea a conseguire

una visione normale. Ci sono alcuni limiti:

un recupero tardivo, le distanze, ecc. La strada

giusta è quella di continuare a portare del materiale

d’uso, in modo tale che si possano soprattutto

agevolare le strutture più povere con piccole

cifre. L’unica cosa è dare loro un supporto neces-

sario per avere un nuovo centro oculistico a Leo.

Non parliamo di grandi cifre (possiamo stimare

60 mila euro per una struttura autonoma), ma

parliamo di una struttura oculistica dignitosa,

ecc. Vengono anche dal Ghana a farsi curare…

Qual è la formazione degli infermieri?

Gli infermieri non c’è bisogno di formarli, sono

più che formati per la cataratta… [infatti gli oculisti

non bastano per eseguire gli interventi perché

ce ne sono pochi, ndr]. Andare in Burkina Faso e

continuare a praticare interventi con un facoemulsificatore

(un intervento costa centinaia di migliaia

di euro) è l’approccio sbagliato. Invece si

tratta di accelerare sulla formazione. Abbiamo finalmente

individuato dei giovani e con loro - che

si sono formati in una facoltà di Oftalmologia del

Mali - abbiamo stipulato un accordo.

L’altro aspetto fondamentale è la chirurgia vitreoretinica,

a cominciare dal vitreo. C’è un’incidenza

elevatissima - più che in Occidente - di

retinopatia diabetica e di drepanocitosi (anemia

falciforme).

In fin dei conti è anche un’avventura. Però

siamo convinti di riuscire a mettere in atto il progetto.

Tornando al discorso del glaucoma…

Come intendete agire nel Burkina Faso?

Innanzitutto stiamo cercando di incrementare,

tra l’altro, l’attività di dépistage (utilizzando un

tonometro portatile). Il problema della terapia è

che alcuni farmaci hanno un costo più elevato.

Mentre colliri a base di timololo hanno un costo

molto basso, quelli di nuova generazione sono

più cari rispetto al nostro Paese (circa il 50 per

cento in più). Quindi noi stiamo aiutando a trovare

dei canali che possano consentire di trovare

dei farmaci a un prezzo più basso, il che è fondamentale.

Nel contesto dell’ultima missione, grazie al supporto

del Prof. Frezzotti dell'Università di Siena,

si sono pianificati una serie di percorsi e protocolli,

per iniziare ad affrontare il glaucoma, che colpisce

i neri più spesso. In Burkina Faso e nella maggior

parte degli altri Paesi africani vengono

operati solamente il 2% dei pazienti o poco più.

Cosa volete fare nella capitale del Burkina

Faso più esattamente?

A giugno è stata programmata una missione

operatoria all’Hôpital Saint Camille di Ouagadougou,

dove si inizierà l’attività chirurgica sul

vitreo. Questa sarà una tappa fondamentale, tenendo

conto che in tutta l’Africa subsahariana

dell’Ovest, in nessun Paese viene effettuato tale intervento.

Il dott. Beni, della clinica oculistica dell’Università

di Firenze, sarà il primo operatore ad

effettuare vitrectomie. Infine a settembre è stata

programmata una missione chirurgica per gli interventi

di glaucoma. Inoltre sono previste giornate

di formazione teorico-pratiche. (g.g.)
STUDIO SCIENTIFICO

Alla ricerca di una cura genetica

della retinite pigmentosa

Medicina di precisione: è stata effettuata una sperimentazione

utilizzando cellule staminali geneticamente riprogrammate ottenute

dalla pelle, che sono state poi fatte evolvere in cellule retiniche


Alexander G. Bassuk*, Andrew Zheng°, Yao Li°, Stephen H. Tsang° e Vinit B. Mahajan§

* Dipartimento di Pediatria, Università dell’Iowa, Iowa City, USA

° Laboratorio di Glaucoma Bernard & Shirlee Brown, Dipartimento di Oftalmologia, Patologia e Biologia cellulare, Istituto di nutrizione umana,

College di medici e chirurghi, Columbia University, New York, USA

§ Dipartimento di Oftalmologia e Scienze visive, Università dell'Iowa, Iowa City, USA
Abstract

Le cellule staminali pluripotenti indotte

(iPSCs), generate a partire dai fibroblasti di

pazienti, potrebbero potenzialmente essere utilizzate,

nelle malattie retiniche, come fonte di

cellule autologhe per il trapianto. Tuttavia, i

pazienti da cui vengono derivate le iPSCs ospiterebbero

ancora le mutazioni che causano la

patologia. Per generare cellule sane derivate

dal paziente tali mutazioni potrebbero essere

riparate con una nuova tecnologia di correzione

genetica basata sul sistema batterico di

ripetizioni palindromiche di gruppi di Dna

estraneo disposti a intervalli regolari (CRISPR/

Cas9), che quindi nel paziente portano a trapianti

che non necessitano di immunosoppressione.

Abbiamo verificato se [la tecnica]

CRISPR/Cas9 potesse essere utilizzata con specifiche

staminali pluripotenti indotte del paziente

per riparare esattamente una mutazione

puntiforme nel gene RPGR che causa la retinite

pigmentosa X-linked (XLRP).

I fibroblasti posti in coltura sono stati ottenuti

da una biopsia della pelle di un paziente

XLRP, i quali erano stati trasdotti in modo tale

che producessero iPSC portatrici della mutazione

c.3070G > T.

Le iPSC sono state trasdotte con CRISPRRNA

guida, endonucleasi Cas9, un template

per donatore omologo. Nonostante le sequenze

ripetitive e ricche di GC2, il 13% delle copie del

gene RPGR ha mostrato una correzione della

mutazione e una conversione nell’allele naturale

[tipo sano, ndr]. Questo è il primo studio

in cui si ricorre alla CRISPR per correggere

una mutazione patogena delle iPSC ottenute da

un paziente con degenerazione dei fotorecettori.

Questa è un’importante dimostrazione di

principio per promuovere lo sviluppo di terapie

personalizzate basate sul trapianto delle iPSC

per la malattia retinica.

Introduzione

L’innesto di cellule staminali per le degenerazioni

retiniche ereditarie come la retinite pigmentosa

(RP) è una terapia in fase di studio. Recenti

trial clinici sui trapianti allogenici a partire da cellule

staminali embrionali umane (hESCs) considerano

la procedura sicura ed efficace.(1) Resta

comunque ancora irrisolto e controverso l’utilizzo

degli embrioni umani, e non va sottovalutato il rischio

di una possibile reazione immuno-mediata.

Impiantando le cellule del paziente stesso, grazie

all’uso di cellule staminali pluripotenti indotte

(iPSCs), si potrebbero evitare queste problematiche

etiche e cliniche. Attraverso protocolli ben stabiliti,(

2) i fibroblasti isolati da una biopsia cutanea

possono essere riconvertiti allo stato pluripotente e

servire da fonte autologa rinnovabile di cellule di

ricambio.

Anche se la mutazione patogenetica originale è

ancora presente in un paziente iPSCs, la sua correzione

è possibile attraverso una tecnica di editing

genetico, definita sistema CRISPR/Cas9,(3) caratterizzato

dall’enzima prodotto dal gene Cas9 e i Clustered

Regularly Interspaced Short Palindromic

Repeats, le ripetizioni palindromiche di gruppi di

DNA estraneo disposti a intervalli regolari.

Il vantaggio dei CRISPR è che la loro specificità

dipende, in gran parte, da un RNA guida (gRNA)

che può essere facilmente programmato per agire

su diversi loci genomici.

In questo studio abbiamo generato iPSCs da un

paziente con una mutazione nel gene regolatore

GTPasi della retinite pigmentosa (RPGR), che provoca

una variante aggressiva X-linked di RP

(XLRP), e abbiamo valutato se CRISPR possa modificare

la mutazione patogenetica, producendo il

gene corretto iPSCs per il suo eventuale utilizzo in

un trapianto autologo.
Metodi

Tutti i protocolli sperimentali, incluso il consenso

informato, sono stati approvati dell’Institutional Review

Board e, una volta ottenute le autorizzazioni

(AAAF1849) presso la Columbia University, tutti

gli esperimenti sono stati eseguiti in conformità con

le linee guida e i regolamenti. Il consenso informato

è stato distribuito a tutti i pazienti.

Le immagini ad autofluorescenza e la tomografia

a coerenza ottica sono state eseguite come descritto.(4)

Per generare le iPSCs, i fibroblasti dermici

sono stati ottenuti da biopsie cutanee in

coltura e riprogrammati in accordo con i protocolli

descritti precedentemente.(5) La pluripotenza è stata

dimostrata in topi immunodeficienti valutando la

capacità di produrre un teratoma (Charles River,

Wilmington, MA) e con la colorazione immunoistochimica

per i marcatori idonei.

I gRNA di CRISPR sono stati selezionati per ridurre

al minimo gli effetti off-target e incrementare

il grado di omologia con la sequenza bersaglio che

comprendeva il sito di mutazione. I candidati, g58

e g59, (g58: GAAGTGGAAGGGGAGGTGGAAGG,

g59: AAGTGGAAGGGGAGGTGGAAGGG), sono

stati inseriti nel vettore di espressione di gRNA/

Cas9 (PBT-U6-Cas9-2A-GFP) e trasfettati ad una

linea di 293 cellule.

Il DNA genomico delle cellule di prova è stato amplificato

mediante PCR utilizzando i primers3 per la

regione RPGR, poi i prodotti di PCR sono stati analizzati

dal SURVEYOR® ( Transgenomic, Omaha,

NE) per l’attività di taglio del DNA. Le espressioni

del plasmide contenenti la sequenza g58 e Cas9 sono

stati poi trasfettati nella linea di iPSC C1145-11*,

derivata dai pazienti, lungo un modello di oligonucleotide

a singolo filamento donatore (ssODN). Dieci

giorni dopo le cellule sono state raccolte e sottoposte

a PCR seguita da sequenziamento mirato, per valutare

la correzione genica nella fase di lettura aperta

(ORF 15, Open Reading Frame 15), nella regione

contenente la mutazione. I prodotti (templates) di sequenziamento

profondo sono stati ottenuti (mediante

PCR) a partire dalla sequenza genomica, che ne rileva

anche alcuni non specifici (che non si visualizzano

sul gel elettroforetico) a causa della copertura

di sequenziamento molto alta. Queste sequenze non

specifiche sono state classificate sotto la voce “nonspecifici/

errore”. Le cellule non trasfettate sono state

utilizzate come controlli.
Risultati

Abbiamo scritto in precedenza della diagnosi di

XLRP associata a RPGR in due fratelli con riduzione

significativa dell’acuità visiva.(6) L’esame del

fondo e le tecniche di imaging mostravano lesioni

maculari tipo “occhio di bue”, con la morte cellulare

dei fotorecettori in prossimità della fovea (Fig.

1A-D). L’intero sequenziamento dell’esone, con la

successiva conferma tramite metodo Sanger, ha

permesso di scoprire una nuova mutazione del gene

RPGR (c.3070G>T, pGlu1024X) all’interno dell’esone

ORF15,6 una sequenza lunga e ripetitiva

ricca di purine che rappresenta più del 60% di

tutte le mutazioni di XLRP.(7) Abbiamo poi messo

in coltura i fibroblasti, che sono stati trascritti in

iPSCs paziente-specifici. Ci siamo accertati che

fossero in grado di differenziarsi in tutti e tre i foglietti

embrionali ed esprimessero i marcatori di

pluripotenza Oct-4, Sox2, SSEA-4, TRA-1-60 e fosfatasi

alcalina (Fig. 1E-L). A questo stato, le cellule

possono essere indotte ed è possibile farne

derivare cellule retiniche, ma vi è un fattore critico

che limita il trapianto: hanno ancora una mutazione

che causa la patologia.

Successivamente abbiamo selezionato 21 gRNAs

con elevata specificità per la regione contenente la

mutazione di RPGR dei pazienti (vedi tabella supplementare).

Due candidati sono stati inseriti sepa-

ratamente in un vettore di espressione contenente

anche l’endonucleasi Cas9, che media il taglio del

DNA target. Il test SURVEYOR® (Transgenomic,

Omaha, NE) ha evidenziato che un candidato, g58,

mostrava un’attività relativamente elevata per il sito

di mutazione (Fig. 2). Erano presenti anche bande

non specifiche perché la sequenza RPGR è altamente

ripetitiva (vedi Metodi). L’efficienza del calcolo

di taglio è stata valutata sulla banda di controllo

(prima della digestione da parte della nucleasi) e

sulle bande specifiche: per g58 era pari circa al

23%, mentre g59 non era attivo.

Dunque g58 è stato utilizzato per l’editing genetico.

Dopo la validazione del gRNA, abbiamo cercato

di determinare se il taglio del DNA mediato

da Cas9, in corrispondenza della mutazione di

RPGR, potesse portare al pathway di riparazione

omologia-diretto (HDR) in presenza di un ssODN

co-trasfettato. Abbiamo trasfettato le iPSCs con il

plasmide che esprimeva g58 gRNA/Cas9 e con un

RPGR anti-senso ssODN. Il sequenziamento profondo

delle cellule trasfettate ha mostrato che il

13% delle letture conteneva la correzione precisa

della mutazione, attraverso la sostituzione del codone

di stop prematuro “TAG” con il codone wildtype

“GAG”, che codifica glutammato al residuo

1024 (Fig. 3). La correzione della mutazione non è

stata riscontrata nelle iPSCs di controllo che non

sono state trasfettate.
Discussione

Il fine terapeutico dell’innesto di

cellule autologhe per le malattie retiniche

degenerative è strettamente

correlato alla capacità di correggere

una mutazione patogena del paziente

prima del trapianto. In questo

studio abbiamo generato iPSCs

paziente-specifici da un paziente affetto

da XLRP e abbiamo dimostrato

che la trasfezione di CRISPR

gRNA/Cas9 su un template di un

donatore omologo corregge una mutazione

puntiforme nella regione

ORF15 del gene RPGR, una sequenza

di DNA difficile da manipolare.

Crediamo che questo sia il

primo esempio di correzione genica

di successo in iPSCs umane associate

a degenerazione retinica ereditaria

[=retinite pigmentosa

X-linked, ndr].

Questo studio dimostra che l’editing

genetico può essere indirizzato

precisamente a una regione altamente

ripetitiva, con alto contenuto

di GC. RPGR si estende su una regione

di 59.000 bp(8) in un genoma

umano contenente oltre 3 miliardi

di basi, ma solo il 13% delle se-

quenze lette aveva la correzione di una mutazione

di un singolo nucleotide all’interno della sequenza

ripetitiva a bassa complessità ORF15, a dimostrazione

che, nonostante i presunti ostacoli tecnici

basati sulla sequenza genomica, il gene

RPGR risponde alla riparazione CRISPR. Questo

tasso di riparazione indica che

l’editing genetico con CRISPR

potrà in futuro fare ragionevolmente

parte del trattamento con

trapianto autologo per altre degenerazioni

fotorecettoriali.

L’alternativa, attualmente quella

più sviluppata, è la terapia genica

di supplementazione. Gli studi clinici

condotti nel 2008 sull’amaurosi

congenita di Leber associata a mutazioni

di RPE assicurano che la terapia

genica è sicura e vantaggiosa

per i pazienti.(9) Tuttavia, i risultati

recentemente pubblicati dei tre

anni di follow-up mostrano che l’aumento

iniziale del grado di sensibilità

retinica si è ridotto nel tempo e

non era accompagnato da miglioramenti

significativi nella determinazione

oggettiva della funzione

visiva.(10) Inoltre, a dosi di vettore

comparabili la terapia genica può

determinare un recupero nettamente

migliore e più duraturo in

modelli animali, suggerendo che le

differenze genetiche tra le specie

potrebbero limitarne la trasposizione

sugli esseri umani. Questi ed

altri limiti della terapia genica, tra

cui la relativa impossibilità di trattare

le forme ereditarie dominanti o

le malattie a tarda insorgenza, potrebbero

essere meglio affrontati attraverso

il trapianto di geni corretti

tramite iPSCs.

Il tasso di correzione del 13%

che abbiamo ottenuto è paragonabile

ad altri studi di editing di

CRISPR omologia-diretto,(11) e supera

i precedenti studi che segnalavano

tassi di correzione più vicini

all’1%.12 Tale percentuale può for-

nire un numero sufficiente di cellule terapeutiche,

ma si deve tener conto che la tecnologia di editing

genetico sta rapidamente migliorando. Il trasposone

piggyBac è un elemento genetico mobile che

può inserire e impostare costrutti esogeni in modalità

“impronta libera” per CRISPR in iPSCs.(12)

Minimizzare gli errori di taglio del meccanismo di

riparazione di saldatura delle estremità non omologhe

(Non-Homologous End-Joining), attraverso

l’inibizione del DNA ligasi IV, può aumentare

anche il numero di cellule riparate.(13) L’analisi

definitiva delle percentuali off-target sarà richiesto

prima di eventuali usi clinici. Dopo aver ottenuto

le iPSCs paziente-specifiche riparate, il

passo successivo è la loro differenziazione clonale

corretta in fotorecettori in grado di integrarsi all’interno

del tessuto retinico. Sebbene vi siano ancora

molte difficoltà strategiche, sono stati

compiuti progressi significativi in esperimenti

pre-clinici, utilizzando cellule precursore dei fotorecettori

post-mitotici o iPSC-derivate in blocco

dal tessuto retinico.(14,15)
Conclusioni

In questo lavoro dimostriamo che le cellule iPSCs

derivate da pazienti portatori di una mutazione patogena

per RP possono essere corrette con la tecnica

di editing genetico CRISPR/Cas9. La nostra

scoperta rappresenta un primo passo concreto per

sviluppare una strategia di trapianto personalizzata

che, sfruttando la combinazione CRISPR/ Cas9 mediata

con iPSCs autologhe, potrebbe essere attuata

per una vasta gamma di malattie retiniche. l



(Traduzione della dott.ssa Caterina Colica, supervisione

scientifica della prof.ssa Francesca Simonelli)


Condividi con i tuoi amici:
1   2   3   4   5   6


©astratto.info 2019
invia messaggio

    Pagina principale